SubtiBank SubtiBank
Version comparison:

2017-10-15 16:45:502025-05-25 08:13:51

description

trigger enzyme

glutamine synthetase, trigger enzyme

locus

BSU17460

BSU_17460

geneLength

1332

1335

function

glutamine biosynthesis, control of TnrA and GlnR activity

glutamine biosynthesis, control of [[protein|TnrA]] and [[protein|GlnR]] activity

product

trigger enzyme

glutamine synthetase, trigger enzyme

outlinks

bsu

BSU17460

BSU_17460

Gene

Coordinates

1,878,425 → 1,879,759

1,878,425 1,879,759

The protein

Catalyzed reaction/ biological activity

ATP L-glutamate NH3 = ADP phosphate L-glutamine (according to Swiss-Prot)

ATP + L-glutamate + NH4+ --> ADP + H+ + L-glutamine + phosphate (according to UniProt)

The protein

Protein family

glutamine synthetase family (according to Swiss-Prot)

glutamine synthetase family (single member, according to UniProt)

The protein

Kinetic information

K(M) for: Glu: 27 mM, ATP: 2.4 mM, ammonium: 0.18 mM; v(max): 3.7 µmol/min/mg

K(M) for: Glu: 27 mM, ATP: 2.4 mM, ammonium: 0.18 mM; v(max): 3.7 mol/min/mg

The protein

[SW|Cofactors]

Mg(2 )

Mg2+

The protein

Structure

[PDB|4LNN] (apo-GS) [Pubmed|24158439]

[PDB|3QAJ] (complex with ATP)

[http://pdb.org/pdb/search/structidSearch.do?structureId=4s0r 4S0R] (the [[protein|TnrA]]-[[protein|GlnA]] complex) [Pubmed|25691471]

[PDB|A general discussion of GS structure]

[PDB|3QAJ] (complex with ATP)

[PDB|4LNN] (apo-GS) [Pubmed|24158439]

[http://pdb.org/pdb/search/structidSearch.do?structureId=4s0r 4S0R] (the [[protein|TnrA]]-[[protein|GlnA]] complex) [Pubmed|25691471]

[PDB|A general discussion of GS structure]

Biological materials

Mutant

GP247 (''glnA::cat''), available in [SW|Jörg Stülke]'s lab

BKE17460 (''glnA''::''ermC'') (available at the [http://www.bgsc.org/ BGSC] and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]

GP2263 (''glnA''::''ermC'') (available in [SW|Jörg Stülke]'s lab)

BP148 (del(''[[gene|glnR]]-[[gene|glnA]]'')::''cat''), available in [SW|Fabian Commichau]'s lab

GP1883 (del(''[[gene|glnR]]-[[gene|glnA]]'')::''ermC''), available in [SW|Fabian Commichau]'s and [SW|Jörg Stülke]'s labs

BKE17460 (Δ[[gene|glnA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGTAAAATTCCTCCT, downstream forward: _UP4_TAATATCTCAATCCCTTGGC

BKK17460 (Δ[[gene|glnA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGTAAAATTCCTCCT, downstream forward: _UP4_TAATATCTCAATCCCTTGGC

GP247 (''glnA::cat''), available in [SW|Jörg Stülke]'s lab

BKE17460 (''glnA''::''ermC'') (available at the [http://www.bgsc.org/ BGSC] and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]

GP2263 (''glnA''::''ermC'') (available in [SW|Jörg Stülke]'s lab)

BP148 (del([[gene|glnR]]-[[gene|glnA]])::''cat''), available in [SW|Fabian Commichau]'s lab

GP1883 (del(''[[gene|glnR]]-[[gene|glnA]]'')::''ermC''), available in [SW|Fabian Commichau]'s and [SW|Jörg Stülke]'s labs

BKE17460 ([[gene|glnA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGTAAAATTCCTCCT, downstream forward: _UP4_TAATATCTCAATCCCTTGGC

BKK17460 ([[gene|glnA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGTAAAATTCCTCCT, downstream forward: _UP4_TAATATCTCAATCCCTTGGC

Biological materials

Expression vector

expression/ purification from ''E. coli'', with N-terminal Strep-tag (in [SW|pGP172]): pGP174, available in [SW|Jörg Stülke]'s lab

pGP177 (N-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab

Biological materials

lacZ fusion

''[[gene|glnR]]-lacZ'': pGP189 (in [[protein|pAC7]]), available in [SW|Jörg Stülke]'s lab

''[[gene|glnR]]-lacZ'': pGP189 (in [SW|pAC7]), available in [SW|Jörg Stülke]'s lab

Labs working on this gene/protein

[SW|Susan Fisher], Boston, USA [http://www.bumc.bu.edu/microbiology/research/susan-h-fisher-phd/ homepage]

References

Original publications

19233925, 20389117, 8799114, 18195355, 11719184, 12139611, 2573733, 8636055, 19233925, 16493705, 16885465, 6141156, 2906311, 20656908, 16055443, 25755103, 18331450, 16547045, 8093698, 21435182, 23535029, 24158439, 15378759, 25691471, 26635369, 26883633

19233925, 20389117, 8799114, 18195355, 11719184, 12139611, 2573733, 8636055, 19233925, 16493705, 16885465, 6141156, 2906311, 20656908, 16055443, 25755103, 18331450, 16547045, 8093698, 21435182, 23535029, 24158439, 15378759, 25691471, 26635369, 26883633, 29794222

The protein

Paralogous protein(s)

[[this]]

Expression and Regulation

additional information

the mRNA is cleaved by [[protein|Rnc|RNase III]] [PubMed|26883633]

Biological materials

Expression vectors

pGP174: expression/ purification from ''E. coli'', with N-terminal Strep-tag (in [SW|pGP172]): , available in [SW|Jörg Stülke]'s lab

pGP177: N-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pBQ200], available in [SW|Jörg Stülke]'s lab

pGP2832: N-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP380], available in [SW|Jörg Stülke]'s lab

labs

[SW|Susan Fisher], Boston, USA [http://www.bumc.bu.edu/microbiology/research/susan-h-fisher-phd/ homepage]